Quegu gugu gugu...

Amid the anxious chirping of the huge birds, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by one, one by

One of the Storm Crows seemed to be different, it was very calm.

Even the King of Storm Crows looked at it from time to time.

This storm ghost crow was transformed by Capricorn!

The Feng Ling clan would never have thought that the Capricorn Lord they were investigating would actually transform into an ordinary storm ghost crow, following the King of the storm ghost crows, and engaged in a cruel battle against the remaining Muluo clan in the immortal tree world.

"Duke, can you start?"

The King of Storm Crow, carefully asked for instructions, that it must treat this mysterious human powerhouse carefully.

He had a strange aura, and the Storm Ghost Crow was very sensitive to it.

It was a kind of fear, a very strong fear.

But this fear is not power, but something else, and it cannot tell what it is.

"Um."

At this moment, among the tens of thousands of Muluo on the ground, a strong Muluo man flew up.

Among his four tentacles, one of them held a ox horn warhammer high, and the skeleton eye sockets showed a light green corrosive aura, suppressing his fear and despair, staring at the king of the storm crows surrounded by many storm crows in the sky.

"Unknown strong man, which beast spirit are you? Our Moluo clan is willing to do his best to provide twice the offerings of the Fengling clan!"

The Wind Spirit Clan worships some alien guardians, some of which are very powerful. The existences such as sandworms and sun birds worshipped by the Moluo clan were all learned from the Wind Spirit Clan during the Hundred Years' War.

The Moluo tribe gathered in the Eternal Tree Realm is not weak.

Strictly speaking, the Moluo tribe forces here are not much different from those in the land of the rotten Shata United Kingdom.

After all, the richness here is far from what the rotten Shata United King can do. It has sufficient resources and the Muras, who have strong vitality in a century, have reproduced an astonishing number, and based on this, many cities are enough to fight the wind spirits for a long time.

In addition, the Moluo here is mostly elite warriors who have mastered the power of withering and rotten power. It is great to deal with the power of the immortal tree of the wind spirits.

If it weren't for the distant human wizard who accidentally discovered these two small civilizations that had lasted for war deep in the melting pot desert, I'm afraid that this eye of the wind, supported by the tree of immortality, would have been completely occupied by Moluo within a few decades.

"Quagu, I smelled the fear in you. It seems that you have known our existence through those destructive cities. Otherwise, there would be the lava beast below. You should be clamoring like those cities, saying something like the decayed gods. You would never be so afraid."

The King of Storm Crows Smiling.

"Call that lava beast out, it is your beast spirit worship? You should already know that your god... has left before you. It has gone miserably and is constantly cursing us."

"Why!"

The leader of the Moluo tribe roared.

"We have never been enemies with you, why do you treat our Moluo tribe like this! Is it because of Feng Ling? We have a tenacious fighting will, but can only live in such a barren place. These Feng Lings are useless, but occupy such a rich area. We just want to survive better. What's wrong with us!"

The King of Storm Crow smiled even brighter.

He had never had such experience in combat communication, but since he followed these wizards to fight, he realized that this kind of verbal conversation that ridiculed his opponent before the war seemed very satisfying!

It has fallen in love with this feeling and seems to be a little addicted.

"Quaguaguaguaguaguaguagua, it's not your fault, it's me, because I'm so strong, I do whatever I like, like crushing a group of ants."

The King of Storm Crow clamored with pride, flapped his wings and roared: "Little ones, kill all the rebels below!"

Queer quack quack!

Countless black shadows of half-human giant birds flapped their black feathers and fell from the sky, diving towards the mushroom fairies with soft tentacles on the ground.

Any Moluo who dares to leave the cave is undoubtedly a strictly trained warrior.

A fierce battle began in full swing.

Only half of the bird transformed by Capricorn, standing in the sky and looking down at all this.

Its eyes fell on the King of Storm Crow.

"The life evolved in this world full of the laws of active mutation evolution is full of talent characteristics. Even this little thing can detect my identity as a traveler in another world. In addition, these primitive tribal lives have very characteristic appearances."

Grand Duke Capricorn had already known the other party's hidden strange talent, and instinctively sensed the information of his foreign travelers!

However, from the perspective of human civilization in the world of Orora, this is just a wild beast. These creatures that have been devoured by him are not even considered civilizations, but can only be regarded as large groups of creatures.

Even the ability to study and utilize the laws has not yet appeared. From the perspective of Capricorn, it is indeed not considered a civilization.

Those betrayers, for so long, have not ruled the world and lived in the starry sky. In the eyes of Grand Duke Capricorn, there are only two reasons. One is the disadvantage of faith becoming a god, and the other is the mysterious death storm in this world.

However, he no longer has time to think about these things.

With the long seal and the erosion of time, although he didn't know how those betrayers survived until now, even level 4 or even level 5 creatures should have died for such a long time, but they survived?

It is very likely that some strange resources in this world have undergone some mutations with the technology mastered by the Olora world.

According to his speculation, the most likely one is the power of the Kingdom of God evolved from Olorra’s space technology!

Otherwise, those guys would not hide in the Kingdom of God every day.

As for his own situation, the reason why he survived until now was because of the long-term powerful sealing power that helped him trap the essence of his inner life in disguise, and he was able to survive ten thousand years later.

Boom! Boom! Boom! Boom! Boom...

These storm ghost crows have very good combat power, but if they want to destroy this heavily guarded city, they will be a little helpless.

Especially the lava monster on the ground appeared behind it!

The lava giant beast with the power of the earth is a body made of magma, burning with light green poisonous fire. Every time a huge rock was thrown into the sky, it would look like a layer of terrible sound waves squirting around, leaving behind a highly poisonous tail mark. More than ten storm ghost crows have died in succession.

"It's these guys who destroyed those cities?"

The desperate leader Moluo was also a little shocked and unbelievable after contacting these storm ghost crows.

Their combat power seems to be no stronger than they imagined.

"Hey, Darga, this is the devil who destroyed more than a dozen cities in your mouth, scaring the Cold Stream Spirit away overnight? Hahaha, it doesn't seem to be very good!"

As the lava beast spoke, it stuffed a storm ghost crow into its mouth and chewed it in big mouth.

"Don't be careless!"

The leader of Moluo still did not relax. He could feel the faint oppressive breath in the air, and took a deep breath and said, "The information will not be wrong. The power of these strange birds is also very special. There may be some changes. Be careful, I want to use that ability to prevent future troubles!"

"you……"
Chapter completed!