typeface
large
in
Small
Turn off the lights
Previous bookshelf directory Bookmark Next

Chapter 197 Master, you are really hypocritical

"Dean, I am willing to go!"

"Dean, I am willing too!"



Zhang Haobo's impassioned speech set off quite a storm in the Department of Infectious Diseases of Wutong Hospital. Two doctors from the Department of Infectious Diseases and nine female nurses from the Department of Infectious Diseases were willing to go with him to the emergency department building for emergency treatment!

"Okay! Let's go!" Zhang Haobo waved his hand and led this group of fresh troops to the emergency building!

The four previously recruited doctors, Han Xingmin, an internal medicine expert from Wutong Hospital, Jiang Chunyan, an obstetrics and gynecology expert, Liu Guokun, the top expert from the Municipal People's Hospital, and Mo Shutong, a pharmacy expert from the Municipal Hospital of Traditional Chinese Medicine, naturally followed!

Liu Guokun looked at the high-spirited Zhang Haobo with admiration: "Old Zhang is still doing a good job! Although he is older, he still maintains a good figure, has a handsome demeanor, and is a handsome old man. Coupled with the magnetic voice of vicissitudes of life,

To his surprise, just by calling him, there were so many female nurses willing to go into danger with him. It really is true that all young and old take advantage of him! Sigh, if it were me, I probably wouldn't be able to recruit even one!"

Han Xingmin repeatedly praised in his heart: "Tsk tsk, look at Dean Zhang's majesty. I guess in the entire Wutong Hospital, only a rising star like Ye Qing can rival him! I, Old Han, feel so incompetent!"

Jiang Chunyan smiled brightly and secretly praised Zhang Haobo for his youthful skills. If he was determined to have an affair, he might even be able to score twice!

Mo Shutong from the Municipal Hospital of Traditional Chinese Medicine has a new understanding of Wutong Hospital: "Well, I used to look down on this joint venture hospital. I always thought that private hospitals were too utilitarian and were just for money and had no medical ethics at all.

When I saw them today, I realized that Wutong Hospital is really a hidden dragon and a crouching tiger! Not to mention others, just Zhang Haobo and Xiao Yeqing, our Traditional Chinese Medicine Hospital does not have such talents!"

Soon, a total of sixteen medical staff arrived at the emergency department building! The doctors and nurses who were left behind breathed a sigh of relief and shouted, "I can finally take a shift and take a nap!"

Especially those old comrades, such as Zheng Changmin and Gao Liping, all fell asleep!

……………………………………………………

The second floor of the Medical Spirit Pagoda, the Miaoshou Realm.

In the valley with flowing springs and waterfalls and lush trees, just like a fairyland in a painting, an antique mansion stands quietly!

Suddenly, a handsome young man in a white coat appeared out of thin air in the courtyard of the house and shouted loudly: "Xiao Yu'er, come out quickly!"

Immediately, there were colorful rays of light condensing in front of him, and a beautiful figure emerged in an instant. The face was like an angel, the snow peaks were towering, the waist was slender, graceful, the curves were graceful, and the two beautiful legs were well-proportioned and slender, which was peerless.

beautiful woman!

"Master, why are you so tired? What bad things have you done?" Xiao Yu'er joked when she saw Ye Qing's tired face and a slight sweat on his forehead.

Ye Qing immediately relaxed a lot. Being called "Master" by such a little beauty sweetly, can you not feel relaxed? Can you not feel elated? Men all have a vanity! Although they usually have

deny!

"Hey, your master, how can I be in the mood to do bad things?" Ye Qing sighed and said, "Your master, I am worried to death!" He thought, even if I want to do bad things, that person is not here! In fact,

Well, even if she doesn't fall ill, she can't do anything bad!

"Master, let Xiao Yu'er serve you!" Xiao Yu'er smiled and flew over lightly, sitting on Ye Qing's shoulder.

Ye Qing suddenly smiled bitterly, this Xiao Yu'er is really a bad person but not a good person. How could he be able to flirt with the master Xi Ge? Look at what he said, it seems like he can really provide that kind of service, but, but, he still dares to be so bold

Sitting on the master's body! It's so rude! Ye Qing really wants to spank her butt!

"Xiao Yu'er, please help me analyze and see what this virus is and whether there are any flaws that can be exploited?" Ye Qing thought of a large group of people waiting for him to save, so he gave up the idea of ​​teasing her and hurriedly started from

He took out a tube of samples from his pocket and handed it to Xiao Yuer!

"What is this?" Xiao Yu'er asked, tilting her delicate neck.

"It's a strange virus. Seventy-four people have been infected in Wutong Hospital now! Maybe there will be more! Seventy-four lives, but it all depends on you, Xiao Yu'er!" Ye Qing said solemnly

.

Xiao Yuer's eyes were bright and her teeth were bright, her body was light and graceful. She smiled and stretched out her delicate hand: "Analyzing the DNA sequence of tiny life, 15 medical spiritual values!"

"Tch, here we go again! Just watch and buckle it yourself!" Even though Ye Qing was in a heavy mood, he was amused by her playful expression. In other words, it would be great if he could really raise such a little slave girl.

!

"Okay! The genetic analysis program is starting..." Immediately, Xiao Yu'er closed her eyes. After a while, a series of information entered Ye Qing's mind, but there was no treatment plan!

Ye Qing asked: "What's the solution? Why isn't there one? If you want medical spiritual points, you can deduct them from me yourself!"

"That, that," Xiao Yu'er showed a rare look of shame and said nonchalantly, "Actually, this is a new type of virus, and I don't have any information in my database!"

Ye Qing's heart suddenly went cold. Why is he so powerful? There is no information in the Medical Spirit Pagoda? You know, this is his only source of reliance and confidence! This time it is miserable!

"What about the detoxifying elixir? Is there one?" Ye Qing pondered for a moment and asked with some persistence.

Xiao Yuer said: "The antidote elixirs are all configured in real time by the system based on the actual situation, but this can only be achieved if there is data in the database and medicinal materials in the space!"

"Then it's gone!" Ye Qing was disappointed again!

Xiao Yuer said with some embarrassment: "Master, in fact, I am just a virtual intelligent life. Although I have stored a lot of medical information, I can only help you exchange it, but I don't know how to use it myself! This time

, it’s all up to you! You have to believe in yourself, as long as you analyze it carefully, think carefully, and summarize and ponder a lot, you will definitely be able to do it!”

Ye Qing looked thoughtful, his eyes suddenly brightened, and he asked: "There is a fragment in the gene sequence of this virus. The sense strand is: CCTCGCCTTTGCCGATCC, and the antisense strand is: GGATCTTCATGAGGTAGTCAGTC0.62kb. Why does it look like a primer? It looks very similar.

It’s common!”

Xiao Yuer also said in surprise: "Master, you have discovered this! Master, you are really amazing! I was about to tell you that this is actually a very common PCR primer called β-actin! Moreover, this primer

, there are absolutely no living things that occur naturally in nature!”

"In other words, this virus is artificially synthesized?" Ye Qing was suddenly shocked! Doesn't this mean that someone deliberately spread this virus? Otherwise, how could it appear in Wutong Hospital? It would not come from nature out of thin air.

Born in!

"Yes! Master, you are so smart! Come on, give me a prize!" Xiao Yu'er said, raising her delicate hands and giving Ye Qing a sweet blowing kiss!

Ye Qing was extremely shocked. He had no time to enjoy this kind of fragrance. He ignored her, which made Xiao Yuer extremely depressed!

He is no longer a member of the pool, and he is learning advanced medical knowledge day and night, but he knows that PCR is just an abbreviation. In biology, it is called polymerase chain reaction (Polymerase Chain Reaction), also known as cell-free molecular cloning, which is specific.

In vitro primer-directed enzymatic amplification technology of sexual DNA sequences.

This technology is a method of in vitro enzymatic synthesis of specific DNA fragments. It consists of several steps such as high-temperature denaturation, low-temperature annealing (renaturation) and appropriate temperature extension. The cycle is carried out so that the target DNA can be rapidly amplified.

, has the characteristics of strong specificity, high sensitivity, easy operation, and time saving. It can not only be used for basic research such as gene isolation, cloning, and nucleic acid sequence analysis, but can also be used for disease diagnosis or anywhere where DNA and RNA are available.

"I never thought that someone could synthesize such a powerful virus! Moreover, it was deliberately poisoned. Who has a grudge against Wutong Hospital? Such a capable person can win the Nobel Prize in Medicine. It is definitely not ordinary.

Man!" Ye Qing felt that this matter suddenly became strange and confusing!

"Master, what's wrong with you? Don't be depressed! Xiao Yu'er has another piece of good news that I haven't told you yet!" Seeing Ye Qing's frown, Xiao Yu'er felt very distressed and immediately clung to him, shaking his arm and comforting him.

He said.

"What's the good news?" Ye Qing turned around and asked.

"Hey, Master, you have discovered a new species. The Medical Spirit Pagoda will reward you with a certain amount of medical spirit value!" Xiao Yuer said happily, as if she herself was about to be rewarded!

Ye Qing asked: "How much is the reward?" It would be boring if it was thirty or fifty!

Xiao Yuer seemed to have guessed what he was thinking, and immediately stretched out ten fingers!

"One hundred?" Ye Qing asked excitedly. This guy is really worthless. Just now he said thirty or fifty was boring, but now he saw it was one hundred, and he immediately became excited!

"One thousand!" Xiao Yu'er rolled her eyes at him with contempt, smiled sweetly, revealing two rows of brilliant white teeth as clear as jade, and said in a sweet voice.

"Wow, a thousand! It's so rich. I've never been so rich! Oh, no, it's the medical value!" Ye Qing suddenly jumped up with joy, but when he thought about there being so many people in the hospital

The patient's life and death were uncertain, especially since Ma Xiaoling was infected, she suddenly felt depressed!

"Master, 1,000 medical spirit points, aren't you happy?"

"Oh, you won't understand!"

"I really don't quite understand!" Xiao Yu'er was confused, thought for a moment, and said while tilting her head.

Ye Qing concentrated on thinking about the treatment method, and seemed to have vaguely found some key points, but he just couldn't figure it out! However, he had a hunch that as long as he worked harder, he would definitely be able to find a solution and kill this damn virus!

Xiao Yuer said: "Master, you have discovered a new species and you have the right to name it. Why not call it Ye's virus?"

Ye Qing waved his hand and said humbly: "This virus has signs of being artificially synthesized, and I didn't create it, so why am I so embarrassed? Well, I think it will be called YY virus!"

Xiao Yuer pursed her lips and sneered: "Tsk, YY, you are not Ye Ye! Master, you are so hypocritical!"


This chapter has been completed!
Previous Bookshelf directory Bookmark Next